Skip to main content

Table 1 Primers used for amplifying and sequencing the 6 th exon of GNAT3 gene

From: Aquatic adaptation and the evolution of smell and taste in whales

Name Sequence loci
G3-6F AGGTGGACAGAGATCTGARAG Within 6th exon of GNAT3 gene
G3-6R TATAAAAGATGAAAATGTGTAGGAT Within 6th exon of GNAT3 gene
note: This pair of primers are designed to amplify a 299 bp-length region including the partial amino coding region of the 6th exon of GNAT3 gene