Table 1 Primers used for amplifying and sequencing the 6 th exon of GNAT3 gene
From: Aquatic adaptation and the evolution of smell and taste in whales
Name | Sequence | loci |
|---|---|---|
G3-6F | AGGTGGACAGAGATCTGARAG | Within 6th exon of GNAT3 gene |
G3-6R | TATAAAAGATGAAAATGTGTAGGAT | Within 6th exon of GNAT3 gene |
note: | This pair of primers are designed to amplify a 299 bp-length region including the partial amino coding region of the 6th exon of GNAT3 gene | |