Skip to main content

Table 1 List of forward and reverse primer sets for PCR amplification

From: Amphioxus mouth after dorso-ventral inversion

Name of gene Forward primer Reverse primer Accession no. Reference
dkk1/2/4 CCGTAACTTGTCCACACCGTAGA GTGCTTTGATGCGTCTTGTTGGG HM590023 Zhang and Mao (2010) [35]
frzb1 a) GTGGTTCCTCCCGTTGTTG GCTTCAGCCGTCTTTCCCA XM002612836 Putnam et al. (2008) [52]
lim1/5 b) AGGGACTCCAAACTGTACTG TTACCACACCGACTCTTCC DQ399521 Langeland et al. (2006) [30]
mef2 c) GCTTATGAGCTGAGTGTGCT GGTTCACTCTTGATCTGCAT EF407505 Zhang et al. (2007) [53]
pax2/5/8 TGTGACAACGACACAGTTCC AACAGCAACTGGATAGTGGC AB193513 Hiruta et al. (2005) [54]
pax3/7 d) GGTGGAGAAGAAGATAGAGG ACGGATGTTCAGTACGCTTG XM002610760 Holland et al. (1999) [55]
pou4 e) ACAACACATCAGCATGCACC GGTTTTGTTTTGACCGTTATT DQ314242 Candiani et al. (2006) [28]
  1. Sequences of Branchiostoma japonicum gene fragments were registered under accession numbers a)AB979875, b)AB980198, c)AB980199, d)AB980200, and e)AB980202