Table 1 PCR primers developed in this study. Hexapoda-specific and Araneae-specific primers were developed at a 5.8S rRNA position involving deletions/insertions (Fig. 1). Reverse primers were designed at the 5′-end of 28S rRNA region. A C3 spacer was added to the 3′-end of each blocking primer for the selective amplification of Hexapoda
Category | Target | Name | Sequence (5′ – 3′) |
|---|---|---|---|
Hexapoda primers | |||
 Forward | Amplification of Hexapoda (excluding Lepidoptera and Sternorrhyncha) | ITS3_Hexa_exSpF | TGTGAACTGCAGGACACATGA |
Amplification of Lepidoptera | ITS3_Lepi_exSpF | TGAACTGCAGGACACATTTGA | |
Amplification of Sternorrhyncha | ITS3_Ster_exSpF | CGAACATCGACMAGTCG | |
 Reverse | Amplification of Hexapoda | ITS4_Hexa_R | TCCTCCGCTTATTAATATGC |
Araneae primers | |||
 Forward | Amplification of Araneae | ITS3_Araneae_F | TGTGAATTGCAGGACACATYG |
 Reverse | Amplification of Araneae | ITS4_Araneae_R | TCCTCCGCTTATTTATATGC |
Blocking Primers | |||
 Forward | Blocking of Araneae | ITS3_BlockAraneae_A | ATTGCAGGACACATTGAGC(C3) |
 Forward | Blocking of Araneae | ITS3_BlockAraneae_B | GACACATTGAGCACTGATT(C3) |