Skip to main content

Table 1 PCR primers developed in this study. Hexapoda-specific and Araneae-specific primers were developed at a 5.8S rRNA position involving deletions/insertions (Fig. 1). Reverse primers were designed at the 5′-end of 28S rRNA region. A C3 spacer was added to the 3′-end of each blocking primer for the selective amplification of Hexapoda

From: DNA metabarcoding of spiders, insects, and springtails for exploring potential linkage between above- and below-ground food webs

Category Target Name Sequence (5′ – 3′)
Hexapoda primers
 Forward Amplification of Hexapoda (excluding Lepidoptera and Sternorrhyncha) ITS3_Hexa_exSpF TGTGAACTGCAGGACACATGA
Amplification of Lepidoptera ITS3_Lepi_exSpF TGAACTGCAGGACACATTTGA
Amplification of Sternorrhyncha ITS3_Ster_exSpF CGAACATCGACMAGTCG
 Reverse Amplification of Hexapoda ITS4_Hexa_R TCCTCCGCTTATTAATATGC
Araneae primers
 Forward Amplification of Araneae ITS3_Araneae_F TGTGAATTGCAGGACACATYG
 Reverse Amplification of Araneae ITS4_Araneae_R TCCTCCGCTTATTTATATGC
Blocking Primers
 Forward Blocking of Araneae ITS3_BlockAraneae_A ATTGCAGGACACATTGAGC(C3)
 Forward Blocking of Araneae ITS3_BlockAraneae_B GACACATTGAGCACTGATT(C3)