Category | Target | Name | Sequence (5′ – 3′) |
---|---|---|---|
Hexapoda primers | |||
Forward | Amplification of Hexapoda (excluding Lepidoptera and Sternorrhyncha) | ITS3_Hexa_exSpF | TGTGAACTGCAGGACACATGA |
Amplification of Lepidoptera | ITS3_Lepi_exSpF | TGAACTGCAGGACACATTTGA | |
Amplification of Sternorrhyncha | ITS3_Ster_exSpF | CGAACATCGACMAGTCG | |
Reverse | Amplification of Hexapoda | ITS4_Hexa_R | TCCTCCGCTTATTAATATGC |
Araneae primers | |||
Forward | Amplification of Araneae | ITS3_Araneae_F | TGTGAATTGCAGGACACATYG |
Reverse | Amplification of Araneae | ITS4_Araneae_R | TCCTCCGCTTATTTATATGC |
Blocking Primers | |||
Forward | Blocking of Araneae | ITS3_BlockAraneae_A | ATTGCAGGACACATTGAGC(C3) |
Forward | Blocking of Araneae | ITS3_BlockAraneae_B | GACACATTGAGCACTGATT(C3) |