Skip to main content

Table 2 Primers and references for PCR protocols for amplification of the four DNA fragments sequenced in the study

From: A new redescription of Richtersius coronifer, supported by transcriptome, provides resources for describing concealed species diversity within the monotypic genus Richtersius (Eutardigrada)

DNA markerPrimer namePrimer directionPrimer sequence (5′-3′)Primer sourcePCR programme
18S rRNA18S_Tar_Ff1forwardAGGCGAAACCGCGAATGGCTC[57][58]
18S_Tar_Rr1reverseGCCGCAGGCTCCACTCCTGG
28S rRNA28S_Eutar_FforwardACCCGCTGAACTTAAGCATAT[59, 60][60]
28SR0990reverseCCTTGGTCCGTGTTTCAAGAC
ITS-2ITS2_Eutar_FfforwardCGTAACGTGAATTGCAGGAC[7][7]
ITS2_Eutar_RrreverseTCCTCCGCTTATTGATATGC
COICOI_Para_FforwardTTTCAACAAACCACAAAGATATYGG[61][9]
COI_Eutar_RrreverseTAAACTTCTGGGTGACCRAARAAYCA
LCO1490forwardGGTCAACAAATCATAAAGATATTGG[62]
COI_Mac_RrreverseTGTTGGTATARAATWGGGTC[101]