Skip to main content

Table 2 Primers with their original references used for amplification of the four DNA fragments sequenced in the study. The primer set LCO1490-JJ + HCO2198-JJ was used for COI amplification in four populations (FI. 066, IT. 337, PL. 015, US. 057), whereas LCO1490 + HCOoutout was used for one population (ME.007)

From: Integrative taxonomy resolves species identities within the Macrobiotus pallarii complex (Eutardigrada: Macrobiotidae)

DNA marker Primer name and source Primer direction Primer sequence (5’-3’)
18S rRNA 18S_Tar_Ff1 [35] forward AGGCGAAACCGCGAATGGCTC
18S_Tar_Rr1 [35] reverse GCCGCAGGCTCCACTCCTGG
28S rRNA 28S_Eutar_F [36] forward ACCCGCTGAACTTAAGCATAT
28SR0990 [37] reverse CCTTGGTCCGTGTTTCAAGAC
ITS-2 ITS2_Eutar_Ff [38] forward CGTAACGTGAATTGCAGGAC
ITS2_Eutar_Rr [38] reverse TCCTCCGCTTATTGATATGC
COI LCO1490-JJ [39] forward CHACWAAYCATAAAGATATYGG
HCO2198-JJ [39] reverse AWACTTCVGGRTGVCCAAARAATCA
LCO1490 [40] forward GGTCAACAAATCATAAAGATATTGG
HCOoutout [41] reverse GTAAATATATGRTGDGCTC