Skip to main content
Download PDF
Download ePub

Correction to: An efficient system for homology-dependent targeted gene integration in medaka (Oryzias latipes)

Zoological Letters volume 5, Article number: 22 (2019) Cite this article

The Original Article was published on 06 July 2017

Correction to: Zoological Lett

https://doi.org/10.1186/s40851-017-0071-x

Please note that there are two errors present in the tables of the published article [1].

Firstly, the value ‘3’ is missing from the 5th row of the ‘GFP+’ column of Table 1.

Table 1 Comparison of integrate efficiency among each of donor plasmids
Full size table

Secondly, the gene sequence given for ‘Candidate #28’ in Additional file 6: Table S3 is incorrect. The gene sequence should be ‘TCTTCGGCCTAGACTGCGAGG’.

Reference

  1. Murakami, et al. An efficient system for homology dependent targeted gene integration in medaka (Oryzias latipes). 2017;3:10. https://doi.org/10.1186/s40851-017-0071-x.

Download references

Author information

Authors and Affiliations

  1. Division of Applied Bioscience, Graduate School of Agriculture, Kyoto University, Kitashirakawa-Oiwake-cho, Sakyo-ku, Kyoto, 606-8502, Japan

    Yu Murakami, Satoshi Ansai, Akari Yonemura & Masato Kinoshita

  2. Present address: Division of Ecological Genetics, Department of Population Genetics, National Institute of Genetics, Yata 1111, Mishima, Shizuoka, 411-8540, Japan

    Satoshi Ansai

Authors
  1. Yu Murakami
    View author publications

    You can also search for this author in PubMed Google Scholar

  2. Satoshi Ansai
    View author publications

    You can also search for this author in PubMed Google Scholar

  3. Akari Yonemura
    View author publications

    You can also search for this author in PubMed Google Scholar

  4. Masato Kinoshita
    View author publications

    You can also search for this author in PubMed Google Scholar

Corresponding author

Correspondence to Masato Kinoshita.

Additional file

Additional file 6:

Table S3. Potential off-target sites of 7 candidates of bait sequence that selected in the first screening and previously reported bait sequences. Potential off-target sites are defined as genomic sequence harboring up to 2 bp mismatches in the total 18 bp sequences and a NGG PAM. (XLSX 10 kb)

Rights and permissions

Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.

Reprints and permissions

About this article

Check for updates. Verify currency and authenticity via CrossMark

Cite this article

Murakami, Y., Ansai, S., Yonemura, A. et al. Correction to: An efficient system for homology-dependent targeted gene integration in medaka (Oryzias latipes). Zoological Lett 5, 22 (2019). https://doi.org/10.1186/s40851-019-0139-x

Download citation

  • Published:

  • DOI: https://doi.org/10.1186/s40851-019-0139-x

Zoological Letters

ISSN: 2056-306X

Contact us