Skip to main content

Advertisement

Correction to: An efficient system for homology-dependent targeted gene integration in medaka (Oryzias latipes)

The original article was published in Zoological Letters 2017 3:10

Correction to: Zoological Lett

https://doi.org/10.1186/s40851-017-0071-x

Please note that there are two errors present in the tables of the published article [1].

Firstly, the value ‘3’ is missing from the 5th row of the ‘GFP+’ column of Table 1.

Table 1 Comparison of integrate efficiency among each of donor plasmids

Secondly, the gene sequence given for ‘Candidate #28’ in Additional file 6: Table S3 is incorrect. The gene sequence should be ‘TCTTCGGCCTAGACTGCGAGG’.

Reference

  1. 1.

    Murakami, et al. An efficient system for homology dependent targeted gene integration in medaka (Oryzias latipes). 2017;3:10. https://doi.org/10.1186/s40851-017-0071-x.

Download references

Author information

Correspondence to Masato Kinoshita.

Additional file

Additional file 6:

Table S3. Potential off-target sites of 7 candidates of bait sequence that selected in the first screening and previously reported bait sequences. Potential off-target sites are defined as genomic sequence harboring up to 2 bp mismatches in the total 18 bp sequences and a NGG PAM. (XLSX 10 kb)

Rights and permissions

Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.

Reprints and Permissions

About this article