Skip to main content

Advertisement

Correction to: An efficient system for homology-dependent targeted gene integration in medaka (Oryzias latipes)

Article metrics

  • 209 Accesses

The original article was published in Zoological Letters 2017 3:10

Correction to: Zoological Lett

https://doi.org/10.1186/s40851-017-0071-x

Please note that there are two errors present in the tables of the published article [1].

Firstly, the value ‘3’ is missing from the 5th row of the ‘GFP+’ column of Table 1.

Table 1 Comparison of integrate efficiency among each of donor plasmids

Secondly, the gene sequence given for ‘Candidate #28’ in Additional file 6: Table S3 is incorrect. The gene sequence should be ‘TCTTCGGCCTAGACTGCGAGG’.

Reference

  1. 1.

    Murakami, et al. An efficient system for homology dependent targeted gene integration in medaka (Oryzias latipes). 2017;3:10. https://doi.org/10.1186/s40851-017-0071-x.

Download references

Author information

Correspondence to Masato Kinoshita.

Additional file

Additional file 6:

Table S3. Potential off-target sites of 7 candidates of bait sequence that selected in the first screening and previously reported bait sequences. Potential off-target sites are defined as genomic sequence harboring up to 2 bp mismatches in the total 18 bp sequences and a NGG PAM. (XLSX 10 kb)

Rights and permissions

Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.

Reprints and Permissions

About this article

Verify currency and authenticity via CrossMark

Cite this article

Murakami, Y., Ansai, S., Yonemura, A. et al. Correction to: An efficient system for homology-dependent targeted gene integration in medaka (Oryzias latipes). Zoological Lett 5, 22 (2019) doi:10.1186/s40851-019-0139-x

Download citation