- Correction
- Open Access
- Published:
Correction to: An efficient system for homology-dependent targeted gene integration in medaka (Oryzias latipes)
Zoological Letters volume 5, Article number: 22 (2019)
Correction to: Zoological Lett
https://doi.org/10.1186/s40851-017-0071-x
Please note that there are two errors present in the tables of the published article [1].
Firstly, the value ‘3’ is missing from the 5th row of the ‘GFP+’ column of Table 1.
Secondly, the gene sequence given for ‘Candidate #28’ in Additional file 6: Table S3 is incorrect. The gene sequence should be ‘TCTTCGGCCTAGACTGCGAGG’.
Reference
Murakami, et al. An efficient system for homology dependent targeted gene integration in medaka (Oryzias latipes). 2017;3:10. https://doi.org/10.1186/s40851-017-0071-x.
Author information
Authors and Affiliations
Corresponding author
Additional file
Additional file 6:
Table S3. Potential off-target sites of 7 candidates of bait sequence that selected in the first screening and previously reported bait sequences. Potential off-target sites are defined as genomic sequence harboring up to 2 bp mismatches in the total 18 bp sequences and a NGG PAM. (XLSX 10 kb)
Rights and permissions
Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.
About this article
Cite this article
Murakami, Y., Ansai, S., Yonemura, A. et al. Correction to: An efficient system for homology-dependent targeted gene integration in medaka (Oryzias latipes). Zoological Lett 5, 22 (2019). https://doi.org/10.1186/s40851-019-0139-x
Published:
DOI: https://doi.org/10.1186/s40851-019-0139-x